Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AA746477.1
Subject Sequence ID: ENSG00000141837
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/AA746477.1, 365 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000141837 (ENSG00000141837), 298924 bp

>gi|2786463|gb|AA746477.1|AA746477 nw62e02.s1 NCI_CGAP_GCB1 Homo sapiens cDNA clone IMAGE:1251194 3' similar to TR:O00555 O00555 NEURONAL CALCIUM CHANNEL ALPHA 1A SUBUNIT ISOFORM A-1. ;contains element TAR1 repetitive element ;, mRNA sequence
>ENSG00000141837

1-281  (473-753)   94% <-
282-365  (1456-1539)   100%

      0     .    :    .    :    .    :    .    :    .    :
      1 GGCCGTATCTCCGGCCAGTAGCGTCGGCCGTGCGGGCCTGGGTACCTCCG
        |||||-||||||||||||  ||-|||||||||-|||||||||||||||||
    473 GGCCG ATCTCCGGCCAGAGGC TCGGCCGTG GGGCCTGGGTACCTCCG

     50     .    :    .    :    .    :    .    :    .    :
     51 AGGGCCGCTGGTGGC GCCCGG CCGGCCTGGCCACCGCCTGCTGCTGCT
        |||||||||||||||-||||||-|||||||||||||||||||||||||||
    520 AGGGCCGCTGGTGGCCGCCCGGCCCGGCCTGGCCACCGCCTGCTGCTGCT

    100     .    :    .    :    .    :    .    :    .    :
     99 GCTGCTGCTGCTGCTGCTGCTGCTGCTGCGGGAACCCCGAGCCGCCGGCG
        ||||||||||||||||||||||||||||||||  ||||||||||||||| 
    570 GCTGCTGCTGCTGCTGCTGCTGCTGCTGCGGGGGCCCCGAGCCGCCGGCC

    150     .    :    .    :    .    :    .    :    .    :
    149 TTACGGATCACAGGGGAATAGGACACGTGTGGCCGGGGGGTGGAGGGGGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    620 TTACGGATCACAGGGGAATAGGACACGTGTGGCCGGGGGGTGGAGGGGGT

    200     .    :    .    :    .    :    .    :    .    :
    199 CTGGGGGAGCTGGCGGCGGCCCC CCG  GATGATGCTGGTACCAGATGT
        |||||||||||||||||||||||-|||--||-|-||||||||||||||||
    670 CTGGGGGAGCTGGCGGCGGCCCCGCCGCGGA G TGCTGGTACCAGATGT

    250     .    :    .    :    .    :    .    :    .    :
    246 TGAGGGGGCTGGGCTTCCACTTACGGAACTACTGCC         CTGCC
        ||||||||||||||||||||||||||||||||||||<<<...<<<|||||
    718 TGAGGGGGCTGGGCTTCCACTTACGGAACTACTGCCCTA...CACCTGCC

    300     .    :    .    :    .    :    .    :    .    :
    287 GGTGCGCCATGTGCTCTCGGCCCTCGCTGGGCGAGCGGGACCAGCGCTGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   1461 GGTGCGCCATGTGCTCTCGGCCCTCGCTGGGCGAGCGGGACCAGCGCTGG

    350     .    :    .    :    .
    337 TCCCGAGCCCGTGCCCGGCCGTGGTCCGG
        |||||||||||||||||||||||||||||
   1511 TCCCGAGCCCGTGCCCGGCCGTGGTCCGG

END