Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AA297815.1
Subject Sequence ID: ENSG00000141837
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/AA297815.1, 371 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000141837 (ENSG00000141837), 298924 bp

>gi|1950148|gb|AA297815.1|AA297815 EST113367 Infant brain Homo sapiens cDNA 5' end similar to similar to calcium channel, N-type, alpha 1 subunit, mRNA sequence
>ENSG00000141837

(complement)

14-141  (276016-276143)   96% ->
142-238  (278698-278794)   95% ->
239-346  (281453-281558)   95% ->
347-371  (291617-291641)   100%

      0     .    :    .    :    .    :    .    :    .    :
     14 ATGNTGAATCTCTTTGTCGCCGTCATCATGGACAACTTTGAGTACCTCAC
        ||| ||||||||||||||||||||||||||||||||||||||||||||||
 276016 ATGCTGAATCTCTTTGTCGCCGTCATCATGGACAACTTTGAGTACCTCAC

     50     .    :    .    :    .    :    .    :    .    :
     64 CCGAGACTCCTCCATCNTGGGCCCCCACCACNTGGATGAGTACGTGCGTG
        |||||||||||||||| |||||||||||||| ||||||||||||||||||
 276066 CCGAGACTCCTCCATCCTGGGCCCCCACCACCTGGATGAGTACGTGCGTG

    100     .    :    .    :    .    :    .    :    .    :
    114 TNTGGGCCGAGTATGACCCCGCAGCTTG         GGGCCGCATGCNT
        | ||||||||||||||||||||||||||>>>...>>>||||||||||| |
 276116 TCTGGGCCGAGTATGACCCCGCAGCTTGGTA...CAGGGGCCGCATGCCT

    150     .    :    .    :    .    :    .    :    .    :
    155 TACCTGGACATGTATCAGATGNTGAGACACATGTCTCCGCCCNTGGGTCT
        ||||||||||||||||||||| |||||||||||||||||||| |||||||
 278711 TACCTGGACATGTATCAGATGCTGAGACACATGTCTCCGCCCCTGGGTCT

    200     .    :    .    :    .    :    .    :    .    :
    205 GGGGAAGAAGTGTCCGGNCAGAGTGGCTTACAAG         CGGCTTN
        ||||||||||||||||| ||||||||||||||||>>>...>>>|||||| 
 278761 GGGGAAGAAGTGTCCGGCCAGAGTGGCTTACAAGGTA...TAGCGGCTTC

    250     .    :    .    :    .    :    .    :    .    :
    246 TGCGGATGGACCTGCCCGTCGCAGATGACAACACCGTCCACTTCAATTCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 281460 TGCGGATGGACCTGCCCGTCGCAGATGACAACACCGTCCACTTCAATTCC

    300     .    :    .    :    .    :    .    :    .    :
    296 ACCNTCATGGCTCTGATCCGCACAGCCNTGGACATCAAGATTGCCCAAGG
        ||| ||||||||||||||||||||||| |||||||||||||||||-||||
 281510 ACCCTCATGGCTCTGATCCGCACAGCCCTGGACATCAAGATTGCC AAGG

    350     .    :    .    :    .    :    .
    346 G         GAGGAGCCGACAAACAGCAGATGGA
        ->>>...>>>|||||||||||||||||||||||||
 281559  GTA...CAGGAGGAGCCGACAAACAGCAGATGGA

END